View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16019_low_20 (Length: 225)
Name: NF16019_low_20
Description: NF16019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16019_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 39629236 - 39629043
Alignment:
| Q |
13 |
agatgaataatttaaaacaagaaattgaaggctataaatgcgatggctagtgataattgacgaaaataaacgagcgtagaccaaaaagagattaaatcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39629236 |
agatgaataatttaaaacaagaaattgaaggctataaatgcgatggctagtgataattgacgaaaataaacgagtgtagaccaaaaagagattaaatcat |
39629137 |
T |
|
| Q |
113 |
gtaggcttatataattagtggttaacatggagggctcattaattgattgaaattgacagaataatgtcaatggtgagtgattatttcattcatt |
206 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39629136 |
gtaggctcatataattagtggttaacgaggagggctcaataattgattgaaattgaaagaataatgtcaaaggagagtgattatttcattcatt |
39629043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University