View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16019_low_7 (Length: 380)
Name: NF16019_low_7
Description: NF16019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16019_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 213 - 370
Target Start/End: Original strand, 29232704 - 29232862
Alignment:
| Q |
213 |
atctaataaagaggttttcatttttaaaatgtgtatattattgtcaatcttttgtggcnnnnnnnnnnnnnnnn-tattgtgtaaatatgaatagtgtaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
29232704 |
atctaataaagaggttttcatttttaaaatgtgtttattattgtcaatcttttgtgcctttttttttaaaaaaaatattgtgtaaatatgaatagtgtaa |
29232803 |
T |
 |
| Q |
312 |
taaatgtgataatttgatgatgatgttgttggagaaaagataaagaaaaataagtgtta |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29232804 |
taaatgtgataatttgatgatgatgttgttggagaaaagataaagaaaaataagtgtta |
29232862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 29232499 - 29232535
Alignment:
| Q |
13 |
cataggggtattatagtacttttataaagtagcaaca |
49 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
29232499 |
cataggggtattatagtacttttattaagaagcaaca |
29232535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University