View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1601_high_11 (Length: 224)
Name: NF1601_high_11
Description: NF1601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1601_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 9601355 - 9601208
Alignment:
| Q |
1 |
tttaaaatgtttccagttgttttagcttccaatttccaatttttatagtacatgtatactcaagcttgtgaactcacatagaagttagttttgcactaaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||| |
|
|
| T |
9601355 |
tttaaaatgtttccaattgttttagcttccaatttccaatttttatagtacatgtatactcaagcttgtgaactcacatagaagtttgttttccattaaa |
9601256 |
T |
 |
| Q |
101 |
catcatagaattaacatgcatttataccatttgttgttgaccttctac |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9601255 |
catcacagaattaacatgcatttataccatttgttgttgaccttctac |
9601208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 9571413 - 9571524
Alignment:
| Q |
1 |
tttaaaatgtttccagttgttttagcttccaatttccaatttttatagtacatgtatactcaagcttgtgaactcacatagaagttagttttgcactaaa |
100 |
Q |
| |
|
||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| || |||| |
|
|
| T |
9571413 |
tttaacatgtttctagttgtttcagcttccaatttccaatttttatagtacatgtacactcaagcttgtgaactaacatagaagtttgttttccattaaa |
9571512 |
T |
 |
| Q |
101 |
catcatagaatt |
112 |
Q |
| |
|
||||| |||||| |
|
|
| T |
9571513 |
catcacagaatt |
9571524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 5 - 112
Target Start/End: Complemental strand, 9604754 - 9604647
Alignment:
| Q |
5 |
aaatgtttccagttgttttagcttccaatttccaatttttatagtacatgtatactcaagcttgtgaactcacatagaagttagttttgcactaaacatc |
104 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||| || |||| ||||| || |||||| | |
|
|
| T |
9604754 |
aaatgtttccagctgtttcggcttccaatttccgatttttatagtacatgtacactcaagcttgtgaactcacgtacaagtctgttttccattaaacaac |
9604655 |
T |
 |
| Q |
105 |
atagaatt |
112 |
Q |
| |
|
| |||||| |
|
|
| T |
9604654 |
acagaatt |
9604647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 149 - 204
Target Start/End: Complemental strand, 2918007 - 2917952
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2918007 |
caggggcggattcacactgaaacatggtgtggcagttgccacaccagattattccc |
2917952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 51513180 - 51513128
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51513180 |
caggggcggatccactgtgaaacatggtgtggcagttgccacactagattatt |
51513128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 149 - 204
Target Start/End: Original strand, 28323073 - 28323128
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28323073 |
caggggcggattcaccttgaaacatggtgtggcacttgccacaccagattattccc |
28323128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 46672908 - 46672856
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
||||||| |||||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
46672908 |
caggggcagatccacactgaaacatgttgcggcacttgccacaccagattatt |
46672856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 4939936 - 4939976
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgcca |
189 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4939936 |
caggggcggatccactatgaaacatggtgtggcagttgcca |
4939976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 29247226 - 29247170
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29247226 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
29247170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 28535210 - 28535242
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
28535210 |
tgaaacatggtgtggcagctgccacaccagatt |
28535242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 33619691 - 33619647
Alignment:
| Q |
153 |
ggcggatccacactgaaacatggtgtggcagttgccacaccagat |
197 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
33619691 |
ggcggatctactgtgaaacatggtgtggcagttgccacatcagat |
33619647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 46913513 - 46913457
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913513 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
46913457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 41969778 - 41969832
Alignment:
| Q |
150 |
aggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41969778 |
aggggcggattcaccttgaaacatggtgtggcacttgccacaccagattattccc |
41969832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 28998020 - 28998068
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagat |
197 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
28998020 |
caggggcggatctactgtgaaacatggtgtggcagttgccacaccagat |
28998068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 201
Target Start/End: Complemental strand, 42897802 - 42897753
Alignment:
| Q |
152 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42897802 |
gggcggatccagtttgaaacatggtgtggcagttgccataccagattatt |
42897753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 187
Target Start/End: Complemental strand, 36617092 - 36617052
Alignment:
| Q |
147 |
accaggggcggatccacactgaaacatggtgtggcagttgc |
187 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
36617092 |
accaggggcggatccacagtgaaatatggtgtggcagttgc |
36617052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 205
Target Start/End: Original strand, 19815109 - 19815164
Alignment:
| Q |
150 |
aggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
|||||||||||||| | | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
19815109 |
aggggcggatccaccataaggcatggtgtggcacttgccacaccagattattcccc |
19815164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 193
Target Start/End: Complemental strand, 46358056 - 46358015
Alignment:
| Q |
152 |
gggcggatccacactgaaacatggtgtggcagttgccacacc |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46358056 |
gggcggatccagtttgaaacatggtgtggcagttgccacacc |
46358015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 194
Target Start/End: Complemental strand, 46458043 - 46457998
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacacca |
194 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||| |
|
|
| T |
46458043 |
caggggcggagctactatgaaacatggtgtggcagttgccacacca |
46457998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 38663020 - 38663052
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
38663020 |
tgaaacatggtgtggcagctgccacaccagatt |
38663052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 2123908 - 2123852
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2123908 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
2123852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 149 - 205
Target Start/End: Original strand, 38740983 - 38741039
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38740983 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
38741039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 149 - 205
Target Start/End: Original strand, 33403424 - 33403480
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33403424 |
caggggcggatctacactgaaacatggtgtggcagttgccacaccagattattcccc |
33403480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 149 - 201
Target Start/End: Original strand, 50158589 - 50158641
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50158589 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
50158641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 205
Target Start/End: Original strand, 32940712 - 32940751
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32940712 |
tgaaacatggtgtggcagttgccacaccagattattcccc |
32940751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 147 - 197
Target Start/End: Original strand, 37187909 - 37187959
Alignment:
| Q |
147 |
accaggggcggatccacactgaaacatggtgtggcagttgccacaccagat |
197 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
37187909 |
accaggggcggatctactgtgaaacatggtgtggcagttgccacaccagat |
37187959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 5458862 - 5458825
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagattattcc |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5458862 |
tgaaacatagtgtggcagttgccacaccagattattcc |
5458825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 29702453 - 29702498
Alignment:
| Q |
156 |
ggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
||||||| | ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29702453 |
ggatccatattgaaacatggtgtggcacttgccacaccagattatt |
29702498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 18431743 - 18431711
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
18431743 |
tgaaacatggtgtggcagctgccacaccagatt |
18431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 12)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 149 - 204
Target Start/End: Complemental strand, 498084 - 498029
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
498084 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
498029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 149 - 204
Target Start/End: Original strand, 50385857 - 50385912
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50385857 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
50385912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 53446077 - 53446021
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53446077 |
caggggcggattcaccttgaaacatggtgtggcacttgccacaccagattattcccc |
53446021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 149 - 195
Target Start/End: Complemental strand, 49430679 - 49430633
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccag |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49430679 |
caggggcggatccactttgaaacatggtgtggcagttgccacaccag |
49430633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 22418553 - 22418601
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagat |
197 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
22418553 |
caggggcggatctactgtgaaacatggtgtggcagttgccacaccagat |
22418601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 201
Target Start/End: Complemental strand, 43055657 - 43055605
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055657 |
caggagcggacccactgtgaaacatggtgtggcagttgccacaccagattatt |
43055605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 205
Target Start/End: Complemental strand, 24758640 - 24758601
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24758640 |
tgaaacatggtgtggcacttgccacaccagattattcccc |
24758601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 205
Target Start/End: Complemental strand, 24767637 - 24767598
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24767637 |
tgaaacatggtgtggcacttgccacaccagattattcccc |
24767598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 29694358 - 29694309
Alignment:
| Q |
156 |
ggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
||||||||| |||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
29694358 |
ggatccacattgaagcatggtgtggcaagtgccacaccaaattattcccc |
29694309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 2125281 - 2125313
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
2125281 |
tgaaacatggtgtggcagctgccacaccagatt |
2125313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 26555493 - 26555525
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
26555493 |
tgaaacatggtgtggcagctgccacaccagatt |
26555525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 28211774 - 28211742
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
28211774 |
tgaaacatggtgtggcagctgccacaccagatt |
28211742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 149 - 203
Target Start/End: Original strand, 34225676 - 34225730
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225676 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcc |
34225730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 149 - 205
Target Start/End: Original strand, 25981135 - 25981191
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25981135 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccaaattattcccc |
25981191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 149 - 204
Target Start/End: Original strand, 3058960 - 3059015
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3058960 |
caggggcaaatccacactaaaacatggtgtggcagttgccacaccagattattccc |
3059015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 205
Target Start/End: Complemental strand, 14396155 - 14396093
Alignment:
| Q |
149 |
caggggcggatccacactgaaacatggtgt------ggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14396155 |
caggggcggatccacagtgaaacatggtgtggcaatggcagttgccacaccagattattcccc |
14396093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 198
Target Start/End: Complemental strand, 18113885 - 18113834
Alignment:
| Q |
147 |
accaggggcggatccacactgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||| |||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18113885 |
accatgggcggatgtacattgaaacatggtgtggcagttgccacaccagatt |
18113834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 198
Target Start/End: Complemental strand, 424878 - 424832
Alignment:
| Q |
152 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
424878 |
gggcggatgtacattgaaacatggtgtggcagctgccacaccagatt |
424832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 205
Target Start/End: Original strand, 39421044 - 39421078
Alignment:
| Q |
171 |
catggtgtggcagttgccacaccagattattcccc |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
39421044 |
catggtgtggcaattgccacaccagattattcccc |
39421078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 2197413 - 2197464
Alignment:
| Q |
153 |
ggcggatccacactgaaacatggtgtggcagtt---gccacaccagattatt |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2197413 |
ggcggatccaccgtgaaacatggtgtggcagttgccgccacaccagattatt |
2197464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 204
Target Start/End: Original strand, 595534 - 595582
Alignment:
| Q |
156 |
ggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595534 |
ggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
595582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 150 - 201
Target Start/End: Original strand, 841944 - 841995
Alignment:
| Q |
150 |
aggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
841944 |
aggggcggatccaccgtgaaacatggtgtggcagttgcaacaccagattatt |
841995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 166 - 195
Target Start/End: Original strand, 13850509 - 13850538
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13850509 |
tgaaacatggtgtggcagttgccacaccag |
13850538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 5014201 - 5014169
Alignment:
| Q |
166 |
tgaaacatggtgtggcagttgccacaccagatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
5014201 |
tgaaacatggtgtggcagctgccacaccagatt |
5014169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 146 - 201
Target Start/End: Original strand, 37622825 - 37622880
Alignment:
| Q |
146 |
taccaggggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
201 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
37622825 |
taccaagggcggatccacattgaaacatggtgtgacacttgccacaccagattatt |
37622880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University