View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1601_high_5 (Length: 265)
Name: NF1601_high_5
Description: NF1601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1601_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 117 - 249
Target Start/End: Complemental strand, 9601560 - 9601428
Alignment:
| Q |
117 |
tattaggcaactttccatgatgctcagttatttattgtcacttgtttgtgccgtttgttagccataaatgaggacacctttaatgatagaaaatggcatg |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9601560 |
tattaagcaactttccatgatgctcagttatttattgttacttgttggtgccgtttgttagccataaatgaggacacctttaatgatagaaaatggcatg |
9601461 |
T |
 |
| Q |
217 |
tttgattgtgcattcatcctttgattactagca |
249 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
9601460 |
tttggttgtgcattcatcctttgattactagca |
9601428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 125 - 228
Target Start/End: Complemental strand, 9605135 - 9605032
Alignment:
| Q |
125 |
aactttccatgatgctcagttatttattgtcacttgtttgtgccgtttgttagccataaatgaggacacctttaatgatagaaaatggcatgtttgattg |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||| ||||||||||| | ||| |||||| | |||||||||||||||||||| |||||||| ||| |
|
|
| T |
9605135 |
aacttcccatgatgctcagttatttattgttacatgttggtgccgtttgtaatccaaaaatgatgtcacctttaatgatagaaaatatcatgtttggttg |
9605036 |
T |
 |
| Q |
225 |
tgca |
228 |
Q |
| |
|
|||| |
|
|
| T |
9605035 |
tgca |
9605032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University