View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1601_high_8 (Length: 236)

Name: NF1601_high_8
Description: NF1601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1601_high_8
NF1601_high_8
[»] chr6 (1 HSPs)
chr6 (1-151)||(4457189-4457339)


Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 4457339 - 4457189
Alignment:
1 tataaaaaagatctaaagttgaaaattcccaacttgttcctaatgtactccctcatgattgagtcatgagagtcattccaccatctgatattatgattag 100  Q
    ||||||||| ||||||||||| | || |||||||||||| |||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||    
4457339 tataaaaaatatctaaagttggacatacccaacttgttcataatgtactcccccataattgagtcatgagagtcattacaccatctgatattatgattag 4457240  T
101 aaaaagataaacttaaattagccataccatatgcgcatgaattgccttctc 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
4457239 aaaaagataaacttaaattagccataccatatgcgcatgaattgccttctc 4457189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University