View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_101 (Length: 259)
Name: NF16020_high_101
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 36503817 - 36504052
Alignment:
| Q |
15 |
cttatttgattaatcttactgcggtgggtgcatttgtggcaccacttctttattattttcataatctttatgtcaatatgacttattggatttattggat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36503817 |
cttatttgattaatcttactgcggtgggtgcatttgtggcaccacttctttattattttcataatctttatgtgaatatgacttattggatttattggat |
36503916 |
T |
|
| Q |
115 |
ttatggagaggagaattcattgcaaaggaaacttacaatctctcttacatttgctatacccatctgtctgatcatattcaagttcaaagcagtttcgcag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36503917 |
ttatggagaggagaattcattgcaaaggaaacttacaatctctcttacatttgctatacccatctgtctgatcatattcaagttcaaagcagtttcgcag |
36504016 |
T |
|
| Q |
215 |
tttatggaaaaaattatggagcttttttcttcatat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36504017 |
tttatggaaaaaattatggagcttttttcttcatat |
36504052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University