View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_104 (Length: 254)
Name: NF16020_high_104
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_104 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 15 - 218
Target Start/End: Original strand, 3821740 - 3821945
Alignment:
| Q |
15 |
atgaaatcaaaaaggaaaatgcaaatagaatgaatctatgctgcttttgattgtcttcccatgttctgtggattaagtttcattagtag-nnnnnnnnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3821740 |
atgaaatcaaaaaggaaaatgcaaatagaatgaatctatgctgcttttgattgtcttcccatgttctgtggattaagtttcattagtagtttttttttat |
3821839 |
T |
 |
| Q |
114 |
nnnnataaaattcatctagtttagtttgattgattga-aannnnnnnnagcatagtgcaaaaacactaaccaaaagaaaatatggtagaaaaccacttct |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3821840 |
ttttataaaattcatctagtatagtttgattgattgacatttttttttagcatagtgcaaaaacactaaccaaaagaaaatatggtagaaaaccacttct |
3821939 |
T |
 |
| Q |
213 |
tgttga |
218 |
Q |
| |
|
|||||| |
|
|
| T |
3821940 |
tgttga |
3821945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University