View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_105 (Length: 254)
Name: NF16020_high_105
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_105 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 45397487 - 45397245
Alignment:
| Q |
1 |
tacgtatacatcttttgccataattatgaacgtcatgagttttggccaattgtctaattttgttgccaattcatttggaattttgttctttttccgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45397487 |
tacgtatacatcttttgccataattatgaacgtcatgagttttggccaattgtctaattttgttgccaattcatttggaattttgttctttttccgtgtg |
45397388 |
T |
 |
| Q |
101 |
tgtaaaggaatatcaataagatgaattagtgaagtgatgcaaacacacgagttgtgaaggacatgcattgtggtgcaattccaaagaactagctagaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45397387 |
cgtaaaggaatatcaataagatgaattagtgaagtgatgcaaacacacgagttgtgaaggacatgcattgtggtgcaattccaaagaactagctagaaaa |
45397288 |
T |
 |
| Q |
201 |
gagtgtatatcccgaaatcttttaaaattcaaatttcatctcact |
245 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45397287 |
ga--gtatatcccgaaatcttttaaaattcaaatttcatatcact |
45397245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University