View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_108 (Length: 249)
Name: NF16020_high_108
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_108 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 13068955 - 13068714
Alignment:
| Q |
9 |
atatgaataatttgacattgtaatttcaaagagcatgattcaaaatttgccaagaaaatttgtaaaataatcacaatat-taccactttaattgataata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13068955 |
atatgaataatttgacattgtaatttcaaagagcatgattcaaaatttgccaagaaaaattgtaaaataatcacaatatataccactttaattgataata |
13068856 |
T |
 |
| Q |
108 |
cttttctcctttgtgtaataatttgtaaaagcaagaagattgcaattacttacgtgagccagtaacttcccaaagctgcatttctccatgctcatactct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13068855 |
cttttctcctttgtgtaataatttgtaaaagcaagaagattgcaattacttacgtgagccagtaacttcccaaagctgcatttctccatgctcatactct |
13068756 |
T |
 |
| Q |
208 |
tctgggcgaatgataataagaatgaggttatcaccttctttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13068755 |
tctgggcgaatgataataagaatgaggttatcaccttctttc |
13068714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University