View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_120 (Length: 237)
Name: NF16020_high_120
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_120 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 25587133 - 25587346
Alignment:
| Q |
15 |
agaaagtaactatt-attgacagctaggcaagtagagttgatagtgaaagaaagaacaaagagtaatcttgtggctgattttgaaacgtactataaattc |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587133 |
agaaagtaactatttattgacagctaggcaagtagagttgatagtgaaagaaaaagcaaagaataatcttgtggctgattttgaaacgtactataaattc |
25587232 |
T |
 |
| Q |
114 |
aatagtgagctgtccaaaaaatgaattaaatagtgtaaaatggcagtgaggaaaggcctttctttcccgctcaaaaacagacaatccgtgttgacacgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25587233 |
aatagtgagctgtccaaaaaatgaattaaatagtgtaaaatggcagtgaggaaaggcctttctttcccgctcaaaaacagacaatccgtgttgacacgag |
25587332 |
T |
 |
| Q |
214 |
gggggacaggaggg |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25587333 |
gggggacaggaggg |
25587346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University