View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_124 (Length: 226)
Name: NF16020_high_124
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_124 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 3063242 - 3063454
Alignment:
| Q |
1 |
gttgctcgcttactccaaaagccatttcatagtacacttgcaacaactaggctatgcgacgcaaaataataaacctaggtccaatatctagagtagttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3063242 |
gttgctcgcttactccaaaagccatttcatagtacacttgcaacaactaggctatgcgacacaaaataataaaactaggtccaatatctagagtagttgg |
3063341 |
T |
|
| Q |
101 |
gcgctaccaatacccccctgctgaacagcagctttatcctcaaggctaacattttgtgttgacttgttgagctcatccaacggctggctgctgctgctgg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3063342 |
gcgctaccaatacccccctcctgaacagcagctttatcctcaaggctaacgttttgtgttgacttgttgagctcatccaacggctg---gctgctgctgg |
3063438 |
T |
|
| Q |
201 |
catccaagggcttcat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3063439 |
catccaagggcttcat |
3063454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University