View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_high_126 (Length: 226)

Name: NF16020_high_126
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_high_126
NF16020_high_126
[»] chr3 (1 HSPs)
chr3 (81-221)||(363621-363761)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 81 - 221
Target Start/End: Complemental strand, 363761 - 363621
Alignment:
81 ttgcatcataatcaattcttccaagtaacataatcgattaaggaatgaaaataagctccacacaattcggacatgcttcttaataattgagtatgccaaa 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
363761 ttgcatcataatcaattcttccaagtaacataatcgattaaggaattaaaataagctccacacaattcggacatgcttcttaataattgagtatgccaaa 363662  T
181 tataataaaataatcagctttgaccaagatgggaaaatact 221  Q
    |||||||||||||||||||||||||||||||||||||||||    
363661 tataataaaataatcagctttgaccaagatgggaaaatact 363621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University