View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16020_high_132 (Length: 216)

Name: NF16020_high_132
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16020_high_132
NF16020_high_132
[»] chr4 (1 HSPs)
chr4 (18-198)||(43634102-43634288)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 43634288 - 43634102
Alignment:
18 agagatcgaaggatgttagatgtg------tgtttcaacataaaaattgttcatactcaggaatcaaacttatattttttcatacgattcttctaagata 111  Q
    ||||||||||||||||||||||||      ||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||    
43634288 agagatcgaaggatgttagatgtgcatgtgtgtttcaacataaaaattgttcatacttagaagtcaaacttatattttttcatacgattcttctaagata 43634189  T
112 gagtaatgatggatatgaaaagtagatgatgataagagataaagaacgaacactgttagatacgtgttttaacctaaaaattgttca 198  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||| ||||||||||||||    
43634188 gaataatgatggatatgaaaagtagatgatgataagagataaagaacgaacagtgttagatacatattttaatctaaaaattgttca 43634102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University