View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_133 (Length: 214)
Name: NF16020_high_133
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_133 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 44845086 - 44844903
Alignment:
| Q |
13 |
gataatacttaagaaaatataataatgaataatggatagtgatatagttgtacctggaaggttaagttctttctgagaagagcgtttgtttgagtaaaga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44845086 |
gatactacttaagaaaatataataatgaataatggatagtgatatagttgtacctggaaggttaagttctttctgagaagagcgtttgtttgagtaaaga |
44844987 |
T |
|
| Q |
113 |
agctagcaggggaaggatctaccatcnnnnnnnggtgtcttggttttctctgacaatgcaaaggctcttactgttatagatata |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44844986 |
agctagcaggggaaggatctaccatctttttttggtgtcttggttttctctgacaatgcaaaggctcttactgttatagatata |
44844903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 108
Target Start/End: Complemental strand, 44858147 - 44858076
Alignment:
| Q |
31 |
ataataatgaataatggatagtgatatagttgtacctggaaggttaagttctttctgagaagagcgtttgtttgagta |
108 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
44858147 |
ataatgatgaataatggattgtgatata------cctggaaggttaaattctttctgagaagagcgtttgcttgagta |
44858076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 44832931 - 44832863
Alignment:
| Q |
63 |
tacctggaaggttaagttctttctgagaagagcgtttgtttgagtaaagaagctagcaggggaaggatc |
131 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| ||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
44832931 |
tacctggaaagttaaattcttcctgagaagtgcgtttgcttgagtacagaagctgataggggaaggatc |
44832863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 116
Target Start/End: Complemental strand, 44868727 - 44868671
Alignment:
| Q |
60 |
ttgtacctggaaggttaagttctttctgagaagagcgtttgtttgagtaaagaagct |
116 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||| |||||||| ||||||| |
|
|
| T |
44868727 |
ttgtacctggaaggttaaattcttcctgagaagaccgttggtttgagtccagaagct |
44868671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 122
Target Start/End: Complemental strand, 44893921 - 44893861
Alignment:
| Q |
62 |
gtacctggaaggttaagttctttctgagaagagcgtttgtttgagtaaagaagctagcagg |
122 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
44893921 |
gtacctggaaggttaaattcttcctgagaagagcgtttgcacgagtagagaaggtagcagg |
44893861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 64 - 122
Target Start/End: Original strand, 12930587 - 12930645
Alignment:
| Q |
64 |
acctggaaggttaagttctttctgagaagagcgtttgtttgagtaaagaagctagcagg |
122 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| |||||| ||||||| ||||| |
|
|
| T |
12930587 |
acctggaaggttaagttctttctaagaagcgcgtttgcttgagtccagaagctggcagg |
12930645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University