View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_135 (Length: 210)
Name: NF16020_high_135
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_135 |
 | |
|
| [»] scaffold0459 (1 HSPs) |
| | |
|
| [»] scaffold0366 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0459 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 5239 - 5058
Alignment:
| Q |
18 |
aaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgnnnnnnnntcaaaacctgcttgctttctacaccgttcgaacccgatccaagga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5239 |
aaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgaaaaaaaatcaaaacctgcttgctttctacaccgttcgaacccgatccaagga |
5140 |
T |
|
| Q |
118 |
ctaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139 |
ctaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
5058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 5239 - 5058
Alignment:
| Q |
18 |
aaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgnnnnnnnntcaaaacctgcttgctttctacaccgttcgaacccgatccaagga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5239 |
aaatcgagatcgcacgttgcagatttcaagctcgatattttagagtgaaaaaaaatcaaaacctgcttgctttctacaccgttcgaacccgatccaagga |
5140 |
T |
|
| Q |
118 |
ctaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139 |
ctaccgatgtgttgacttcatgaatgtgtgggattgtgattgcatgcaatccgaagccttttcaatatgttatttcatctca |
5058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University