View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_36 (Length: 415)
Name: NF16020_high_36
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 123 - 227
Target Start/End: Complemental strand, 35120062 - 35119958
Alignment:
| Q |
123 |
gaagataaaatggacaagacaatattgcctaaggttatgcaagtcaagcaatttggtcgtagtggaagaactaagtggtcacatttggtcaaggaggaca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| ||| ||||||| ||||||| |
|
|
| T |
35120062 |
gaagataaaatggacaagacaatattgcccaaggttatgcaagtcaagcactttggtcgcagtggaagaactaaatggtcccatctggtcaatgaggaca |
35119963 |
T |
|
| Q |
223 |
ctact |
227 |
Q |
| |
|
||||| |
|
|
| T |
35119962 |
ctact |
35119958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 48 - 123
Target Start/End: Original strand, 2975135 - 2975210
Alignment:
| Q |
48 |
tcaattacattgcgtgctttctattgtgccgtcatgaaaatctaaatatttgttagtttgtttcatgttctggatg |
123 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||||||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
2975135 |
tcaatgacattgcgtgctttctatcttgccgtcgtgaaaatctaaacatttgttagtttgttttatgttttggatg |
2975210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 93
Target Start/End: Original strand, 3080300 - 3080337
Alignment:
| Q |
56 |
attgcgtgctttctattgtgccgtcatgaaaatctaaa |
93 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
3080300 |
attgcgtgctttctatcgtgccgtcgtgaaaatctaaa |
3080337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University