View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_40 (Length: 398)
Name: NF16020_high_40
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 113 - 374
Target Start/End: Complemental strand, 47437441 - 47437173
Alignment:
| Q |
113 |
ccataaagactgtttttaacttcagttttgacatatcataaaatacaccgtgaggtttgaagaaacatagtgacgtaaaataatatatatcacacaagca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47437441 |
ccataaagactgtttttaacttcagttttgacatatcataaaattcaccgtgaggtttgaagaaacatagtgacgtaaaataatatatatcacacaagca |
47437342 |
T |
|
| Q |
213 |
tgtctggtcttnnnnnnnnnnnngatccaagcaattttgatcttcattacacgcaacttcaagcacaacaa---caaaa--agtg--tcacaccaaaatg |
305 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| | | | |||| ||||||||||| |
|
|
| T |
47437341 |
tgtctggtcttgaaaaagaaaaagatccaagcaattttgatctttattacacgcaacttcaagcacaacaatttcgagactagtgcaaaacaccaaaatg |
47437242 |
T |
|
| Q |
306 |
tggttgatcatcctcaaccagtgcaaaaacaacaatttcgagacatgccaatcaacatcacatcttcaa |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47437241 |
tggttgatcatcctcaaccagtgcaaaaacaacaatttcgagacatgccaatcaacatcacttcttcaa |
47437173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 45
Target Start/End: Complemental strand, 47437536 - 47437502
Alignment:
| Q |
11 |
catagggaaatgcattggtataaaattgatgtatc |
45 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47437536 |
catagggaaatacattggtataaaattgatgtatc |
47437502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University