View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_44 (Length: 389)
Name: NF16020_high_44
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 47 - 159
Target Start/End: Original strand, 54301342 - 54301454
Alignment:
| Q |
47 |
ggatgcgtgtgtacgttactgttattatatgtaaatatgtaatcaaccaaaaaagatactagtattggatacgaacaggagcaagtaacggcgataaagg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54301342 |
ggatgcgtgtgtacgttactgttattatatgtaaatatgtaatcaaccaaaaaagatactagtattggatacgaacaggagcaagtaacggcgataaagg |
54301441 |
T |
|
| Q |
147 |
gaacgaacggaac |
159 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54301442 |
gaacgaacggaac |
54301454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 242 - 342
Target Start/End: Original strand, 54301541 - 54301641
Alignment:
| Q |
242 |
tttgagagttctcatttcttaacccaaccggacagcctgccactctggtcactgtgggcccacccacggccctctccagcccttctctttttatttattt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54301541 |
tttgagagttctcatttcttaacccaaccggacagcctgccactctggtcactgtgggcccacccacggccctctccagcccttctctttttatttattt |
54301640 |
T |
|
| Q |
342 |
t |
342 |
Q |
| |
|
| |
|
|
| T |
54301641 |
t |
54301641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University