View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_48 (Length: 374)
Name: NF16020_high_48
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 22 - 356
Target Start/End: Original strand, 44314083 - 44314417
Alignment:
| Q |
22 |
taacagaaaacatatgtgagatactaacacaagttattaagaagataaattttatttagaatagataagagaaggcttcagcgttgcttataaactgcgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44314083 |
taacagaaaacatatgtgagatactaacacaagttattaagaagataaattttatttagaatagataagagaaggcttcagcgtcgcttataaactgcgt |
44314182 |
T |
|
| Q |
122 |
ccgagcttgttacgtatcttactaatataatcagaagccaatccatcaacacaaagctctttatttggattaacatcgtgaagtctctctttatggatca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314183 |
ccgagcttgttacgtatcttactaatataatcagaagccaatccatcaacacaaagctctttatttggattaacatcgtgaagtctctctttatggatca |
44314282 |
T |
|
| Q |
222 |
aatactccgttgatcggttgcttccaactgacttgataacatacgtagggtttgcgcggctctgcggctgttgtgaccttctactgcttgctggaaattg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314283 |
aatactccgttgatcggttgcttccaactgacttgataacatacgtagggtttgcgcggctctgcggctgttgtgaccttctactgcttgctggaaattg |
44314382 |
T |
|
| Q |
322 |
cttattagaaaccaatttttccttcataggttcct |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314383 |
cttattagaaaccaatttttccttcataggttcct |
44314417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University