View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_61 (Length: 340)
Name: NF16020_high_61
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 48695792 - 48696129
Alignment:
| Q |
1 |
aatggtactgtcttctgtctgtgaccaccgtcttcttggccctct--------ctctctcactcacacacgggccatacaagtgcactctttgccatcaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48695792 |
aatggtactgtcttctgtctgtgaccaccgtcttcttggccctctctctctctctctctcactcacacacgggccatacaagtgcactctttgccatcaa |
48695891 |
T |
 |
| Q |
93 |
gcaagacatcatcttctctcaaggttttgcgtgcaaatagaaataatctttcaaaacaagtggattcaagtttccgaatgatacccccaagcaaatcaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48695892 |
gcaagacatcatcttctctcaaggttttgcgtgcaaatagaaataatctttcaaaacaagtggattcaagtttccaaatgatacccccaagcaaatcaaa |
48695991 |
T |
 |
| Q |
193 |
tctctcacaaaacaagtagtaactgttaagttaaacagtttagagtctttccattatgtgactgttgtgctgtgctgttaaagcaggtgattcaaactac |
292 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48695992 |
tctctcacaaaacaagtagtaactgttacgttaaacagtttagagtctttccattatgtgactgttgtgctgtgctgttaaagcaggtgattcaaactac |
48696091 |
T |
 |
| Q |
293 |
ataatcgtttacagaaattacatctccaccacaggttc |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48696092 |
ataatcgtttacagaaattacatctccaccacaggttc |
48696129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University