View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_67 (Length: 322)
Name: NF16020_high_67
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 19 - 314
Target Start/End: Original strand, 43893163 - 43893458
Alignment:
| Q |
19 |
caaagccttcttctgctcatttatgaaattcaagtacaggcaaataaggatcaatatggaaggcacggaaacttttaaaaccagcagaaatgccaagttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43893163 |
caaagccttcttctgctcatttatgaaattcaagtacaggcaaataaggatcaatatggaaggcacggaaacttttaaaaccagcagaaatgccaagttg |
43893262 |
T |
|
| Q |
119 |
tttgaattgttcttcagttctgtgttttcccttggttctatacattgtcattatccatatgtcagctgccaacaatgctcttgttcttttactctcatcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43893263 |
tttgaattgttcttcagttctgtgttttcccttggttctatacattgtcattatccatatgtcagctgccaacaatgctcttgttcttttactctcatcg |
43893362 |
T |
|
| Q |
219 |
gtctgctccggtaacaccggttcacaaagaatcaattttccagccaccggaagagccttgtaacaactttgcaaggccttcttgaattcttcatct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43893363 |
gtctgctccggtaacaccggttcacaaagaatcaattttccggccaccggaagagccttgtaacaactttgcaaggccttcttgaattcttcatct |
43893458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 19 - 314
Target Start/End: Original strand, 43903755 - 43904050
Alignment:
| Q |
19 |
caaagccttcttctgctcatttatgaaattcaagtacaggcaaataaggatcaatatggaaggcacggaaacttttaaaaccagcagaaatgccaagttg |
118 |
Q |
| |
|
||||| |||||||||||||||| |||||||| || ||||| |||||||||||||| ||||||||||| |||| ||||||||||||||||||||| || |
|
|
| T |
43903755 |
caaaggcttcttctgctcatttctgaaattctagaacaggaaaataaggatcaatgtggaaggcacgaaaacgaagaaaaccagcagaaatgccaagctg |
43903854 |
T |
|
| Q |
119 |
tttgaattgttcttcagttctgtgttttcccttggttctatacattgtcattatccatatgtcagctgccaacaatgctcttgttcttttactctcatcg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||| | | |||||||||||||||||||| |||||||||| |
|
|
| T |
43903855 |
tttgaattgttcttcagttctgtgttttcccttagttttatacattgtcattatgaatatgtcacccgacaacaatgctcttgttctttgactctcatcg |
43903954 |
T |
|
| Q |
219 |
gtctgctccggtaacaccggttcacaaagaatcaattttccagccaccggaagagccttgtaacaactttgcaaggccttcttgaattcttcatct |
314 |
Q |
| |
|
||| |||||||| |||| || ||||||| |||||||||||| |||||||||||||||||| || | |||||| |||||||| ||||||||||| |
|
|
| T |
43903955 |
gtcagctccggtgacactggctcacaaacaatcaattttccgttcaccggaagagccttgtagcagttctgcaagaccttcttgcattcttcatct |
43904050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University