View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_68 (Length: 321)
Name: NF16020_high_68
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_68 |
 |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0179 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 13 - 110
Target Start/End: Complemental strand, 33294 - 33197
Alignment:
| Q |
13 |
gagacagagtgagttggagagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag |
110 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33294 |
gagacagagttagttggagagacaatgacggtgggcttcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag |
33197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 176 - 235
Target Start/End: Complemental strand, 33135 - 33076
Alignment:
| Q |
176 |
ccactatggcaaatgatgccacatgggatgtgtgtagggtgtgtatggttcaaaagggat |
235 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33135 |
ccactatgacaaatgatgccacatgggatgtgtgtatggtgtgtatggttcaaaagggat |
33076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 233 - 318
Target Start/End: Complemental strand, 33563662 - 33563577
Alignment:
| Q |
233 |
gattataactacaagaaagaatcatgtagccattgaactgccatgataaaatggaacccaacagataataattggagccaatagca |
318 |
Q |
| |
|
||||||||| |||||||| | || | ||||||||||||||| || ||||||||||||||||| | ||| |||||||||||| |||| |
|
|
| T |
33563662 |
gattataacgacaagaaatattcctatagccattgaactgctataataaaatggaacccaactgctaacaattggagccaacagca |
33563577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 110
Target Start/End: Complemental strand, 47289183 - 47289107
Alignment:
| Q |
31 |
gagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag |
110 |
Q |
| |
|
||||||| |||| ||||| ||||||||||| |||||||||||||||| |||| |||| |||| ||||||||||||||| |
|
|
| T |
47289183 |
gagacaaagacgatgggcttcatccccgaacttagggaaagagggatcgaactgagagcaag---ggcacaaagtttcag |
47289107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University