View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_72 (Length: 315)
Name: NF16020_high_72
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 299
Target Start/End: Original strand, 41781490 - 41781777
Alignment:
| Q |
11 |
atgaagctccattttcaggtaattattgtattccattcccacatttggagaaatcacaaatgctacgtgatctattannnnnnnngttgatttgcataac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41781490 |
atgaagctccattttcaggtaattattgtattccattcacacatttggagaaatcacaaatgctacgtgatctattattttttt-gttgatttgcataac |
41781588 |
T |
 |
| Q |
111 |
nnnnnnnggaggatgaaaccgattgttattaaaattggaatgatcaatgtaacaaaattttgtacaacataaaatgctggnnnnnnntgtgcctaattgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
41781589 |
tttttttggaggatgaaaccgattgttattaaaattggaatgatcaatgtaacaaaattttgtacaacataaaatgctggaaaaaaatgtgccgaattgt |
41781688 |
T |
 |
| Q |
211 |
ctaattcagattaagattacatttcataaattcatagcatcataacaactagtaccatttgattggaatttattgtttgtacatatatc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41781689 |
ctaattcagattaagattacatttcataaattcatagcatcataacaactagtaccatttgattggaatttattgtttgtacatatatc |
41781777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University