View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_89 (Length: 278)
Name: NF16020_high_89
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 51755784 - 51755611
Alignment:
| Q |
1 |
ttaggggttgggatcctccagaagattacggcgagccatgtccataaatggttgaagaaatcgaagctcaagtagttgaaagctagagtgtcaagtggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51755784 |
ttaggggttgggatcctccagaagatgacggcgagccatgtccataaatggttgaagaaatcgaagctcaagtagttgaaagctagagtgtcaagtggag |
51755685 |
T |
|
| Q |
101 |
aattttctgacatgttcatctctgtgagcgtgttc-----ttcttttaacttttgatggtaagagtggaggggg |
169 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
51755684 |
aattttctaacatgttcatctctgtgagcgtgttcttctcttcttttcacttttgatggtaagagtggaggggg |
51755611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University