View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_high_90 (Length: 276)
Name: NF16020_high_90
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_high_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 34691003 - 34690755
Alignment:
| Q |
18 |
aaagttttgatagttcatatttaaatgagcactgagtttgtcaaattatactaataccaagattttgtaaaagctctaaaatatagtttttgtcaaaatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34691003 |
aaagttttgatagttcatatttaaatgagcactgaatttgtcaaattatactaataccaagattttgtaaaagctctaaaatatagtttttctcaaaatc |
34690904 |
T |
|
| Q |
118 |
gtggtgtcgtgatttcgctatttcatcgtcaatctagacatgtagttaattttaaggagactaaaattgtcaatttaattatatctgttatttattatca |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34690903 |
gtggtggcgtgatttcgctatttcatcgtcaatctagacatgcagttaattttaaggtgactaaaattgtcaatttaattatatctgttatttattatca |
34690804 |
T |
|
| Q |
218 |
atggttttgcttattatttgagccaatactattgcctactggctctctg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34690803 |
atggttttgcttattatttgagccaatactattgcctactggctctctg |
34690755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 117
Target Start/End: Complemental strand, 3675667 - 3675628
Alignment:
| Q |
78 |
gattttgtaaaagctctaaaatatagtttttgtcaaaatc |
117 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
3675667 |
gattttgttaaagctctaaagtatagtttttgtcaaaatc |
3675628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 123
Target Start/End: Complemental strand, 27858229 - 27858184
Alignment:
| Q |
78 |
gattttgtaaaagctctaaaatatagtttttgtcaaaatcgtggtg |
123 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
27858229 |
gattttgataaagctctaaaatgtagcttttgtcaaaatcgtggtg |
27858184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University