View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_100 (Length: 259)
Name: NF16020_low_100
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 330876 - 331097
Alignment:
| Q |
18 |
acccttgaggtggatatccttgtggaggatgtccttcctttgcatcagatggtggataacctattcataataaataaatcatgagattgattgagaaatg |
117 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
330876 |
acccttgtggtggatacccttgtggaggatgtccttcctttgcatcagatggtggataacctattcataa---ataaatcatgagattga----gaaatg |
330968 |
T |
 |
| Q |
118 |
taaaatgaataaagc-------agacaaagcaatcaataatgattacgtatgtaccttgaggcggtggaaccccgaccggtggttgttgctgattgtatt |
210 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
330969 |
taaaatgaataatgcggacattagacaaagcaatcaataatgattacgtatgtaccttgaggcggtggaaccccgaccggtggttgttgctgattgtatt |
331068 |
T |
 |
| Q |
211 |
gactcattggtggcgatgatggctgttat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
331069 |
gactcattggtggcgatgatggctgttat |
331097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University