View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_104 (Length: 255)
Name: NF16020_low_104
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_104 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 28 - 255
Target Start/End: Original strand, 9080364 - 9080591
Alignment:
| Q |
28 |
gggtctgtcattggaattactagagttgaagctggttatcattggcgttcttttagcgcaaaaggttttccttgttgggaatcaacctccctagttctaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9080364 |
gggtctgtcattggaattactagagttgaagctggttatctttggcgttcttttagcgcaaaaggttttccttgttgggaatcaacctccctagttctag |
9080463 |
T |
 |
| Q |
128 |
ttgccatttgtttgcctatcaatatcaatctcaaatagctaaatgaattacatgcaccaaaagaagtgttgttttcgttctctcgaatacattatttgag |
227 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9080464 |
ttgccagttgtttgcctatcaatatcaatctcaaatagctaaatgaattacatgcaccaaaagaagtgttgttttcgttctctcgaatacattatttgag |
9080563 |
T |
 |
| Q |
228 |
tgattgatatgaaaaagaagtgttatat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9080564 |
tgattgatatgaaaaagaagtgttatat |
9080591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 39 - 153
Target Start/End: Complemental strand, 33602326 - 33602212
Alignment:
| Q |
39 |
tggaattactagagttgaagctggttatcattggcgttcttttagcgcaaaaggttttccttgttgggaatcaacctccctagttctaattgccatttgt |
138 |
Q |
| |
|
|||||| ||||| | ||||||||||| | ||||| | ||||||| ||||||| |||||||| ||| || | |||||||| |||| ||||||| |||| |
|
|
| T |
33602326 |
tggaatcactagcgctgaagctggttctggttggcttgcttttagtgcaaaagattttccttattgcgattaaacctccccggttcaaattgccggttgt |
33602227 |
T |
 |
| Q |
139 |
ttgcctatcaatatc |
153 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33602226 |
ctgcctatcaatatc |
33602212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University