View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_108 (Length: 250)
Name: NF16020_low_108
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_108 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 34674257 - 34674482
Alignment:
| Q |
14 |
aaatggatccttttgaacagacactatttagggctttgcccaatttctatgcttttattttatga---tgtagttctttgctgcagccagatctttggtt |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34674257 |
aaatggatccttttgaaaagacactatttagggctttgcccaatttatatgcctttattttatgatgatgtagttctttgctgcagccagatctttggtt |
34674356 |
T |
|
| Q |
111 |
cgatttatttagttttgtgatgaaatctatatatataacttttttcttggtcatgtggagctgaattccggaagaagaaagatacatatatacatgtaag |
210 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34674357 |
caatttatttagttttgcgatgaaatctatatatataactttttacttggtcatgtagagctgaattccggacgaagaaagatacatatatacatgtaag |
34674456 |
T |
|
| Q |
211 |
ttttgctatatgcactagtgaagaag |
236 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
34674457 |
ttttgctgtatgcactagtgaagaag |
34674482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University