View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_115 (Length: 245)
Name: NF16020_low_115
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_115 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 81 - 230
Target Start/End: Original strand, 781255 - 781404
Alignment:
| Q |
81 |
tataggaccaaatttcatcctaaaaatcagtaaaagataaaaataaatgtgttgtaaagttaagtgtacaactcatgcttaaaaagagtgtataatttag |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781255 |
tatatgaccaaatttcatcctaaaaatcagtaaaagataaaaataaatgtgttgtaaagttaagtgtacaactcatgcttaaaaagagtgtataatttag |
781354 |
T |
 |
| Q |
181 |
atggtaaaatgatacggagaaatttgatatgttctggtgtaggttcatta |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
781355 |
atggtaaaatgatacggagaaatttgatatgttgcggtgtaggtttatta |
781404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 781126 - 781208
Alignment:
| Q |
1 |
ttttgtgctttcctttgcttatgggcattcccaccctattaatgatttcaggactgagtggggcttgaaacaaacattaatat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781126 |
ttttgtgctttcctttgcttatgggcattcccaccctattaatgatttcaggactgagtggggcttgaaacaaacattaatat |
781208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University