View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_116 (Length: 243)
Name: NF16020_low_116
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_116 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 85 - 180
Target Start/End: Complemental strand, 2372459 - 2372364
Alignment:
| Q |
85 |
tttatgtgtttattattattacaggacaacgagaggaatattgtagtttatgagagaaataataataaacatagaaacaatttagtaaataataat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2372459 |
tttatgtgtttattattattacaggacaacgagaggaatattgtagtttaggagtgaaataataataaacatagaaacaatttagtaaataataat |
2372364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 2371391 - 2371335
Alignment:
| Q |
65 |
tcaatttagggaaccaattgtttatgtgtttattattattacaggacaacgagagga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2371391 |
tcaatttagggaaccaattgtttatgtgtttattattattacaggacaacgagagga |
2371335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 74
Target Start/End: Complemental strand, 2372305 - 2372248
Alignment:
| Q |
17 |
aaactacggctaaaattttcttttttcctcttacatatgcgttggtcgtcaatttagg |
74 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2372305 |
aaactacggataaaattttcttttttcctcttacatatgcgttggtcgtcaatttagg |
2372248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University