View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_121 (Length: 237)
Name: NF16020_low_121
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_121 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 13068509 - 13068732
Alignment:
| Q |
17 |
gttatgtcccgtgaaacattctcattctcattctaatacatcataaccaaaaatcaaaattaattacatatcaaacacccatttacacataattacacaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13068509 |
gttatgtcccgtgaaacattctcattctcattctaatacatcataacaaaaaatcaaaattaattacatatcaaacacccatttacacataattacacaa |
13068608 |
T |
|
| Q |
117 |
gtgaac---aacaatcaatatggcaagtgcaaggagattgggcatagctatggatttctcaccatgcagcattaaggcttttcaatggacagtggataac |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13068609 |
gtgaacgacaacaatcaatatggcaagtgcaaggagattgggcatagctatggatttctcaccatgcagcattaaggcttttcaatggacagtggataac |
13068708 |
T |
|
| Q |
214 |
attgtgaaagaaggtgataacctc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13068709 |
attgtgaaagaaggtgataacctc |
13068732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University