View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_124 (Length: 232)
Name: NF16020_low_124
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_124 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 47382704 - 47382490
Alignment:
| Q |
1 |
ccttaatgtgtccatggatataagttctttggtggcattcacatcacatcattgtttcannnnnnnnngcttatgaccaatagtattaataagattttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47382704 |
ccttaatgtgtccatggatataagttctttggtggcattcacatcacatcattgtttcatttttttt-gcttatgaccaatagtattaataagattttaa |
47382606 |
T |
 |
| Q |
101 |
ttcacatatattcccgtataaattaatgttgatttagtttgcgtatagaacttaacttcgaagagtaatttggttagggattttaagtacccctatatat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47382605 |
ttcacatacattcccgtataaattaatgttgatttagtttgcgtatagaacttaacttcgaagagtaatttggttagggattttaagtacccctatatat |
47382506 |
T |
 |
| Q |
201 |
tcccttaccaaaaaac |
216 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
47382505 |
tcccttaccgaaaaac |
47382490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University