View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_128 (Length: 226)
Name: NF16020_low_128
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 81 - 221
Target Start/End: Complemental strand, 363761 - 363621
Alignment:
| Q |
81 |
ttgcatcataatcaattcttccaagtaacataatcgattaaggaatgaaaataagctccacacaattcggacatgcttcttaataattgagtatgccaaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
363761 |
ttgcatcataatcaattcttccaagtaacataatcgattaaggaattaaaataagctccacacaattcggacatgcttcttaataattgagtatgccaaa |
363662 |
T |
 |
| Q |
181 |
tataataaaataatcagctttgaccaagatgggaaaatact |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
363661 |
tataataaaataatcagctttgaccaagatgggaaaatact |
363621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University