View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_129 (Length: 225)
Name: NF16020_low_129
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_129 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 33 - 225
Target Start/End: Original strand, 7500416 - 7500608
Alignment:
| Q |
33 |
tcttaccgttggagtatatagtgaatttgttcataggttgaacttggatcttagtgaacaaaggctttggctctccatgtaaagatatatcaatggcatg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500416 |
tcttaccgttggagtatatagtgaatttgttcataggttgaactcggatcttagtgaacaaaggctttggctctccatgtaaagatatatcaatggcatg |
7500515 |
T |
|
| Q |
133 |
gatcaatttatttatgggacgatacagacagtgagattgattataatggtgaatggaaggaaacgcgtcggagaagaaggaacggtaaccacc |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500516 |
gatcaatttatttatgggacgatacaaacagtgagattgattataatggtgaatggaaggaaacgcgtcggagaagaaggaacggtaaccacc |
7500608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 224
Target Start/End: Complemental strand, 8057466 - 8057420
Alignment:
| Q |
178 |
atggtgaatggaaggaaacgcgtcggagaagaaggaacggtaaccac |
224 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
8057466 |
atggtgaatggcagggaacgcgtcggagaagaaagaacgataaccac |
8057420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University