View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_130 (Length: 225)
Name: NF16020_low_130
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_130 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 29292146 - 29292009
Alignment:
| Q |
13 |
gagaagaatacaatgcaatgctagctgaaaaatcaatggggtcaaagtaattttatttctcaagttattagccctcagcaattagttttatttggtatcg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29292146 |
gagaggaatacaatgcaatgctagctgaaaaatcaatggggtcaaagtaattttatttctcaagttattagccctcagcaattagttttatttggtatcg |
29292047 |
T |
 |
| Q |
113 |
aagcacttaaactaaagttcatatctagttgaagctat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29292046 |
aagcacttaaactaaagttcatatctaggtgaagctat |
29292009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 29291965 - 29291904
Alignment:
| Q |
148 |
tatatatataatcaaaagttaactaatggttctcaatgtcttctatatgatgataaaataat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29291965 |
tatatatataatcaaaagttaactaatggttctcattgtcttctatatgatgataaaataat |
29291904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University