View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_131 (Length: 222)
Name: NF16020_low_131
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_131 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 21 - 206
Target Start/End: Original strand, 44730337 - 44730522
Alignment:
| Q |
21 |
tgtaaaacaaggtaatgtatgcaatgagaagtgatgtttgttaaaccgctccatcttgtgaagaatataatggtggacttggtagttttgatttggctcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730337 |
tgtaaaacaaggtaatgtatgcaatgagaagtgatgtttgttaaaccgctccatcttgtgaagaatataatggtggacttggtagttttgatttggctcg |
44730436 |
T |
 |
| Q |
121 |
gttgttggctatgacatgagttacaactacgacaagtacactacttaaccaatttttgactttataattggatcagtatccttcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730437 |
gttgttggctatgacatgagttacaactacaacaagtacactacttaaccaatttttgactttataattggatcagtatccttcat |
44730522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University