View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_134 (Length: 216)
Name: NF16020_low_134
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_134 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 43634288 - 43634102
Alignment:
| Q |
18 |
agagatcgaaggatgttagatgtg------tgtttcaacataaaaattgttcatactcaggaatcaaacttatattttttcatacgattcttctaagata |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43634288 |
agagatcgaaggatgttagatgtgcatgtgtgtttcaacataaaaattgttcatacttagaagtcaaacttatattttttcatacgattcttctaagata |
43634189 |
T |
 |
| Q |
112 |
gagtaatgatggatatgaaaagtagatgatgataagagataaagaacgaacactgttagatacgtgttttaacctaaaaattgttca |
198 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||| |||||||||||||| |
|
|
| T |
43634188 |
gaataatgatggatatgaaaagtagatgatgataagagataaagaacgaacagtgttagatacatattttaatctaaaaattgttca |
43634102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University