View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_136 (Length: 214)
Name: NF16020_low_136
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_136 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 36060619 - 36060801
Alignment:
| Q |
14 |
ttatacttagaaacatgcaagtacttaataannnnnnnngcttttcatcatgctaatgcatgtttcagttccacactcatctctctatcttccccgttaa |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060619 |
ttatacttagagacatgcaagtacttaataattttttttgcttttcatcatgctaatgcatgtttcagttccacactcatctctctatcttccccgttaa |
36060718 |
T |
|
| Q |
114 |
agtagcttttctgtcttagcacttttaggcaagcaggtgataatgttttattctctcgaagttaataaaggacatgaccaaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060719 |
agtagcttttctgtcttagcacttttaggcaagcaggtaataatgttttattctctcgaagttaataaaggacatgaccaaaa |
36060801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University