View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_21 (Length: 497)
Name: NF16020_low_21
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 11 - 483
Target Start/End: Original strand, 45984712 - 45985178
Alignment:
| Q |
11 |
cataggcacatacctccccttgtcgccacactcccttgttacgttaactactcaaaaacagacgacaatttgaatcattttgaagaattgtacttcattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45984712 |
cataggcacatacctccccttgtcgccacactcccttgttacgttaactactcaaaaacagacgacaatttgaatcattttgaagaattgtacttcattg |
45984811 |
T |
 |
| Q |
111 |
cataatgaaaaattgttttgaaggtcctcaaggttggaagtggtttccattactcttcttgcaacgaggaggtccttcaattcgcctatgacacaaatag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45984812 |
cataatgaaaaattgttttgaaggtcctcaaggttggaagtggtttccattactcttcttgcaacgaggaggtccttcaattcgcctatgacacaaatag |
45984911 |
T |
 |
| Q |
211 |
aaaccggattgctccgaacactaaattaaagcggtgcaacaactgccccccacagctgatcaaccaccaaaacttcccttctattatatacaaatgtcaa |
310 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45984912 |
aaaccggattgctccgaacac-----taaagcggtgcaacaactgcaccccacagctgatcaaccaccaaaacttcccttctattatatacaaatgtcaa |
45985006 |
T |
 |
| Q |
311 |
aaagtcgtggattgtggggattcttattccagtgattctactaagtgtgtgttttttgtagtagtggaagtgnnnnnnnngaacgtttggactgattcta |
410 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
45985007 |
aaagtcgtggattgtggggattcttattctagtgattctactaagtgtgtatttgttgtagtagtggaagtg-aaaaaaagaacgtttggattgattcta |
45985105 |
T |
 |
| Q |
411 |
tattttgcagctttgatattttcacggcaaaattgcgtagggactcgagaatcttgcttttgctgcatatcca |
483 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45985106 |
cattttgcagctttgttattttcacggcaaaattgcgtagggacacgagaatcttgcttttgctgcatatcca |
45985178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 393 - 483
Target Start/End: Original strand, 6455708 - 6455798
Alignment:
| Q |
393 |
acgtttggactgattctatattttgcagctttgatattttcacggcaaaattgcgtagggactcgagaatcttgcttttgctgcatatcca |
483 |
Q |
| |
|
||||||| |||||| ||| |||||| ||||||| ||||||||||| |||||||| |||||| ||||||| |||||||||| || |||||| |
|
|
| T |
6455708 |
acgtttgcactgatgctacattttgtagctttgttattttcacggaaaaattgcttagggatgcgagaattttgcttttgccgcgtatcca |
6455798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 393 - 483
Target Start/End: Original strand, 12294755 - 12294845
Alignment:
| Q |
393 |
acgtttggactgattctatattttgcagctttgatattttcacggcaaaattgcgtagggactcgagaatcttgcttttgctgcatatcca |
483 |
Q |
| |
|
||||||| ||| || ||| |||||| ||||||| |||||||||||||||||||| ||||||| ||||||| || |||||| ||||||||| |
|
|
| T |
12294755 |
acgtttgcactaatgctacattttgtagctttgttattttcacggcaaaattgcctagggacgtgagaatcctggttttgccgcatatcca |
12294845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 408 - 483
Target Start/End: Complemental strand, 3406251 - 3406177
Alignment:
| Q |
408 |
ctatattttgcagctttgatattttcacggcaaaattgcgtagggactcgagaatcttgcttttgctgcatatcca |
483 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||| |||||||| |||||| ||||||| |||| ||||| ||||||||| |
|
|
| T |
3406251 |
ctatatattgtagctttgttattttcacggtaaaattgcttagggatgcgagaattttgc-tttgccgcatatcca |
3406177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University