View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_55 (Length: 362)
Name: NF16020_low_55
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 225 - 343
Target Start/End: Original strand, 53118593 - 53118711
Alignment:
| Q |
225 |
tcttatactcttattattcaacaaatgataataatttacactaactcttttctttgtgtgtacaatcagatcaaatgagtgtggtcacgtattcacatta |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118593 |
tcttatactcttattattcaacaaatgataataatttacactaactcttttctttgtgtgtacaatcagatcaaatgagtgtggtcacgtattcacatta |
53118692 |
T |
|
| Q |
325 |
tgaatgtagacaacgggat |
343 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53118693 |
tgaatgtagacaacgggat |
53118711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 53118378 - 53118499
Alignment:
| Q |
14 |
ttattcttaagtttgtatagtgtaaaatagaaattgacgtactgattgatagaaaattatatatttataaaatggcataaacatgctattaaatacgtca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118378 |
ttattcttaagtttgtatagtgtaaaatagaaattgacgtactgattgatagaaaattatatatttataaaatggcataaacatgctattaaatacgtca |
53118477 |
T |
|
| Q |
114 |
att-aatatattataccgaaac |
134 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
53118478 |
attaaatatattataccgaaac |
53118499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University