View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_60 (Length: 351)
Name: NF16020_low_60
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 151 - 336
Target Start/End: Complemental strand, 18257728 - 18257541
Alignment:
| Q |
151 |
aattataatttccaagaatacgacatttttgttcagtttttgccttcttatatat--tctattttcacttgataacaaccataccttgattcaaatatac |
248 |
Q |
| |
|
||||||||| | |||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18257728 |
aattataatgttcaagaataggacaattttgttcagtttttgccttcttatatatattctattttcacttgataacaaccatacctggattcaaatatac |
18257629 |
T |
 |
| Q |
249 |
atggtgatatccaatagatcaatataaaatgtaaaggcgaagcatatttttgttttattgtttgttactattaatgctttctctgtct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18257628 |
atggtgatatccaatagatcaatataaaatataaaggcgaaggatatttttgttttattgtttgttactatttatgctttctctgtct |
18257541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University