View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_71 (Length: 316)
Name: NF16020_low_71
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 780840 - 781149
Alignment:
| Q |
1 |
ttgacaatgagaaaagaaaacatgtcacctttgaaagtggggatggaatactcatattgtaaggagctttttgagtagaacatgggacttatgaaagagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
780840 |
ttgacaatgagaaaagaaaacatgtcacctttgaaagtggggatggaatactcatattgtaaggagctttttgagtataacatgggacttatgaaagagg |
780939 |
T |
|
| Q |
101 |
cattgaatttggagcactctaaagtgcactcactttaaaaatcataaaatccattcttcatgataaaggaccaaaatcatcaaatgtcatatatcaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780940 |
cattgaatttggagcactctaaagtgcactcactttaaaaatcataaaatccattcttcatgataaaggaccaaaatcatcaaatgtcatatatcaatca |
781039 |
T |
|
| Q |
201 |
aagctttcctatatcaaccattaaccgtgccttagggcttcaacagtttattctccactaccatttttatttcttggttgttccatttttgtgctttcct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781040 |
aagctttcctatatcaaccattaaccgtgccttagggcttcaatagtttattctccactaccatttttatttcttggttgttccatttttgtgctttcct |
781139 |
T |
|
| Q |
301 |
ttgcttatgg |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
781140 |
ttgcttatgg |
781149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University