View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_79 (Length: 298)
Name: NF16020_low_79
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_79 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 282
Target Start/End: Complemental strand, 7643695 - 7643420
Alignment:
| Q |
7 |
tcgaagaaaatgtaatacaattgcctataaattaaagtcgctaaaaacaaaaggcataaatatgtaaacaaactttgtcgtcggatctagttttatgagc |
106 |
Q |
| |
|
||||| ||||||||||| || |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7643695 |
tcgaaaaaaatgtaatagaactgcctacaaattaaagtcgctaaaaacaaaaagcataaatatgtaaacaaactttgtcgtcggatctagttttatgagc |
7643596 |
T |
|
| Q |
107 |
tcatgtggtttcgacgatagttctattggatcctagatcagttgcgtcgcaaagtgaactttgggttcgtttcattcctggattatgtggttcgcttcga |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7643595 |
tcatgtggtttcgacaatagttctattggatcctagatcagttgcgtcgcaaagtgaactttgggttcgtttcattcctggattatgcggttcgcttcga |
7643496 |
T |
|
| Q |
207 |
tctagatatgttagttcgttgatatccttcaagattgccatgtttgcaagattttaagttagctttgttttaactg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7643495 |
tctagatatgttagttcgttgatatccttcaagattgccctgtttgcaagattttaagttagctttgttttaactg |
7643420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University