View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16020_low_87 (Length: 283)
Name: NF16020_low_87
Description: NF16020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16020_low_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 40451750 - 40452022
Alignment:
| Q |
1 |
gtgaagaatgttatcgggtaagtcactaatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtgtaatgattcattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451750 |
gtgaagaatgttatcgggtaagtcactaatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtgtaatgattcattg |
40451849 |
T |
 |
| Q |
101 |
atgagatatgcttgattgcccaagaaaaggtatggaagatggtggacatctttggacaccatgttgctgctcatctttctaggtctcatgttcaaatctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451850 |
atgagatatgcttgattgcccaagaaaaggtatggaagatggtggacatctttggacaccatgttgctgctcatctttctaggtctcatgttcaaatctg |
40451949 |
T |
 |
| Q |
201 |
gtgataacaattcaaatgttggacgaatccattcaggcattgccctggcttcaattaggtcctgttgatgatg |
273 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40451950 |
gtgataacaattcaaatgttggacgagtccattcaggcattaccctggcttcaattaggtcctgttgatgatg |
40452022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 90 - 171
Target Start/End: Complemental strand, 40275904 - 40275820
Alignment:
| Q |
90 |
atgattcattgatgagatatgcttgattgcccaagaaaaggtatgg---aagatggtggacatctttggacaccatgttgctgct |
171 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||| | ||||||||| |||||| |||||||| |||||||||| | ||||||| |
|
|
| T |
40275904 |
atgattcattgatgagatatgctttactccccaaaacaaggtatggaagaagatgatggacatcattggacaccaagctgctgct |
40275820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University