View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16021_low_12 (Length: 223)
Name: NF16021_low_12
Description: NF16021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16021_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 3766872 - 3766683
Alignment:
| Q |
18 |
aagaaaggagaagtttgatatcattgttggagatttggctgacccacttgaagatggtccttgctatcagctctacactaagtccttctatgagaaagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3766872 |
aagaaaggagaagtttgatatcattgttggagatttggctgacccacttgaagatggtccttgctatcagctctacactaagtccttctatgagaaagtt |
3766773 |
T |
 |
| Q |
118 |
gtgaagcctaaacttactgagaatggcatttttgtgacccaggtatacttttgaagaacacacttttatgttagacagttgttcaataag |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3766772 |
gtgaagcctaaactcactgagaatggcatttttgtgacccaggtatacttttgaagaacacacttttatgttagacagttgttcaataag |
3766683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 25 - 164
Target Start/End: Complemental strand, 48389388 - 48389249
Alignment:
| Q |
25 |
gagaagtttgatatcattgttggagatttggctgacccacttgaagatggtccttgctatcagctctacactaagtccttctatgagaaagttgtgaagc |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||| |||||| ||| ||||| ||||| || || || || || |||||||| || || |||| | |
|
|
| T |
48389388 |
gagaaatttgatatcattgttggagatttggcagacccagttgaaggtggaccttgttatcaactttatacaaaatcgttctatgaaaatattctgaaac |
48389289 |
T |
 |
| Q |
125 |
ctaaacttactgagaatggcatttttgtgacccaggtata |
164 |
Q |
| |
|
| || || | |||||||| |||||||||||| |||||||| |
|
|
| T |
48389288 |
ccaagctcaatgagaatgacatttttgtgactcaggtata |
48389249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University