View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16021_low_13 (Length: 215)
Name: NF16021_low_13
Description: NF16021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16021_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 41430316 - 41430138
Alignment:
| Q |
19 |
ctatgctcatgactcgctccaactcttcaaccaaaatctgagcaacctgaattatatgtcctaagttcgtaagttaatttttcaacatgttatgttacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41430316 |
ctatgctcatgactcgctccaactcttcaaccaaaatctgagcaacctgaattatatgtcctaagttcgtaagttaatttttcaacatgttatgttacgt |
41430217 |
T |
 |
| Q |
119 |
tattattaagattgtgtatttagttttagtagtgcatactagccgcataaatgtctatatccacacacgttggttagaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41430216 |
tattattaagattgtgtatttagttttactagtgcatactagccgcataaatgtctatctccacacacgttggttagaa |
41430138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University