View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16022_high_12 (Length: 348)
Name: NF16022_high_12
Description: NF16022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16022_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 9 - 317
Target Start/End: Original strand, 5115165 - 5115473
Alignment:
| Q |
9 |
agtagcaaaggtatcaaaatatggctgcattgttttatacttttcttaatacttatgtgagtccaaatagaaacaatagagcatttaagtctcattttct |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5115165 |
agtaccaaaggtatcaaaatatggctgcattgttttatacttttcttaatacttatgtgagtccaaatagaaacaatagagcatttaagtctcattttct |
5115264 |
T |
|
| Q |
109 |
gtcaactcggatatgcctcatatagaatcaagctgataacaacaatacattatacatattccatactttgcaacttgaaatatgcatataaatagtacga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5115265 |
gtcaactcggatatgcctcatatagaatcaagctgataacaacaatacattatacatattccatactttgcaacttgaaatatgcatataaatagtacga |
5115364 |
T |
|
| Q |
209 |
aatgcccctttttctttatacatatatagaaactgaaaatatagagtttctttgtcaaatgttattatggcattaatcttggaggggatgcatcattttt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
5115365 |
aatgcccctttttctttatacatatatagaaactgaaaataaagagtttctttgtcaaatgttattatggcattagttttggaggggatgcatcattttt |
5115464 |
T |
|
| Q |
309 |
ccactctta |
317 |
Q |
| |
|
||||||||| |
|
|
| T |
5115465 |
ccactctta |
5115473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University