View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16022_high_14 (Length: 325)
Name: NF16022_high_14
Description: NF16022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16022_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 317
Target Start/End: Complemental strand, 10283305 - 10283006
Alignment:
| Q |
14 |
atcaaaatcaaggacctaagtcagaattaaagctcaaaaacaacctctgtttcaacaaacaaaccaattactatattgtctgttttgaaacttgggaggt |
113 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10283305 |
atcaaaatcaagcacctaagtcagaattaaagctcaaaaacaacctctgtttcaacaaacagaccaattactatattgtctgttttgaaacttgggaggt |
10283206 |
T |
 |
| Q |
114 |
gcagagaggaagatagatagataggtagttgtgatggcaatgggaggtgacatgtggaaggctcatatgagcatggctttggtgcagttattatatggtg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10283205 |
gcagagaggaagatagatagatag----ttgtgatggcaatgggaggtgacatgtggaaggctcatatgagcatggctttggtgcagttattatatggtg |
10283110 |
T |
 |
| Q |
214 |
gctaccatgtcatcaccaaagttgcccttaatgttggagtcaaccaacttgtcttctgcttctatagagatctccttgctctcttcattatttctccctt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10283109 |
gctaccatgtcatcaccaaagttgcccttaatgttggagtcaaccaacttgtcttctgcttctatagagatctccttgctctcttcattatttctcccat |
10283010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 208 - 298
Target Start/End: Original strand, 10284748 - 10284838
Alignment:
| Q |
208 |
atggtggctaccatgtcatcaccaaagttgcccttaatgttggagtcaaccaacttgtcttctgcttctatagagatctccttgctctctt |
298 |
Q |
| |
|
||||||||||||||||||| || || || |||||||||| ||||||||||||| | ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10284748 |
atggtggctaccatgtcattactaaggtggcccttaatgctggagtcaaccaattagtcttctgcttctatagggatctccttgctctctt |
10284838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 208 - 317
Target Start/End: Original strand, 10300971 - 10301080
Alignment:
| Q |
208 |
atggtggctaccatgtcatcaccaaagttgcccttaatgttggagtcaaccaacttgtcttctgcttctatagagatctccttgctctcttcattatttc |
307 |
Q |
| |
|
||||||| ||||||||||| || || || |||||||| | ||||||||||||| | |||||||||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
10300971 |
atggtggataccatgtcattactaaggtggcccttaacgctggagtcaaccaattagtcttctgcttctatagagatctcattgccctcctcattatttc |
10301070 |
T |
 |
| Q |
308 |
tccctttgct |
317 |
Q |
| |
|
|||| ||||| |
|
|
| T |
10301071 |
tcccattgct |
10301080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 208 - 317
Target Start/End: Original strand, 10292512 - 10292621
Alignment:
| Q |
208 |
atggtggctaccatgtcatcaccaaagttgcccttaatgttggagtcaaccaacttgtcttctgcttctatagagatctccttgctctcttcattatttc |
307 |
Q |
| |
|
||||||| ||| |||| || || ||||| ||||| ||| ||||||||| ||| | |||||||||||||||||||||||| |||| || ||||| |||| |
|
|
| T |
10292512 |
atggtggatactatgttattactaaagtagccctcaattctggagtcaatcaattagtcttctgcttctatagagatctcattgcccttctcattctttc |
10292611 |
T |
 |
| Q |
308 |
tccctttgct |
317 |
Q |
| |
|
|||| ||||| |
|
|
| T |
10292612 |
tcccattgct |
10292621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University