View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16022_low_18 (Length: 267)
Name: NF16022_low_18
Description: NF16022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16022_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 49623974 - 49623779
Alignment:
| Q |
19 |
taacgttgttgagatcttttgctgatgagaggttgagttctaaagttttgtattccattatggggttacctacgttgttaattattactatagattttaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49623974 |
taacgttgttgagatcttttgctgatgagaggttgagttctaaagtcttgtattccattatggggttacctacgttgttaattattactatggattttaa |
49623875 |
T |
 |
| Q |
119 |
ttggtgcagtttagtgatataaataagaattgatttgcgtgtttttgttattatatggttgtttgaggaagtaagtaatatgagttaattgacgtcaag |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49623874 |
ttggtgcagtttagtgatataaatacgaattgatttgcgtgtttttgttattatatggttgtttgaggaagta---aatatgagttaattgacgtcaag |
49623779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University