View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16022_low_21 (Length: 232)
Name: NF16022_low_21
Description: NF16022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16022_low_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 5115482 - 5115694
Alignment:
| Q |
18 |
gggtacctggaacttgtatatattataaacatatacaactactttgaacaaatttaattttgatatataacgtcaatgtaaatgctttttcacttcaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5115482 |
gggtacctggaacttgtatatattataaacatatacaactactttgaacaaatttaattttgatatataacgtcaatgtaaatgctttttcacttcaagt |
5115581 |
T |
 |
| Q |
118 |
taatcatgaattgtcgannnnnnnnnnataatctatcgactttaactttttatttgctacttaatttaatcttaaagaattaaaaagttacacataatac |
217 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
5115582 |
taatcataaattgtcga-tttttttttataatctatcgactttaactttttatttgctacttaatttaatcttaaggaatt-aaaagttacacataatac |
5115679 |
T |
 |
| Q |
218 |
tatttgattgatgac |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5115680 |
tatttgattgatgac |
5115694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University